View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12350_high_8 (Length: 246)
Name: NF12350_high_8
Description: NF12350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12350_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 34466516 - 34466755
Alignment:
| Q |
1 |
gtatgaatcgttagattctcatctttctttacttatatcactcataatcgttagattctcatctttctctctatatctcttgtaaggctattannnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466516 |
gtatgaatcgttagattctcatctttctttacttatatcactcataatcgttagattctcatctttctctctatatctcttgtaaggctattattttttt |
34466615 |
T |
 |
| Q |
101 |
ctcaatgtacccctaccttgaccatagatcttgtgcaaaatatatatgtagaacgcgccagcataaatgaattgaccaatatcggtcatctataaaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466616 |
ctcaatgtacccctaccttgaccatagatcttgtgcaaaatatatatgtagaacgcgccagcataaatgaattgaccaatatcggtcatctataaaatat |
34466715 |
T |
 |
| Q |
201 |
gaatgttttgcttacacagctgcatatacacaggttctgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34466716 |
gaatgttttgcttacacagctgcatatacacagtttctgc |
34466755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University