View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12350_low_4 (Length: 344)
Name: NF12350_low_4
Description: NF12350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12350_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 27 - 333
Target Start/End: Original strand, 20165288 - 20165591
Alignment:
| Q |
27 |
tttatgttgttgattcagtattacatattgattttgagttatggtattattgtttggaaaagatatgtttcagaattgtcactttgcatttgtaatttct |
126 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20165288 |
tttatgttgttgattcagtcttacatattgattttgcgttatggtattattgtttggaaaagatatgtttcagaattgtcactttgcatttgtaatttct |
20165387 |
T |
|
| Q |
127 |
ttgtttgaagtttatttgtattgaatatcaatgcaatgagtaataatatctaattcctgtggagatgtctaacttttctttcttatgcttttgttttact |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20165388 |
ttgtttgaagtttatttgtattgaatatcaatgcaatgagtaat---atctaattcctgtggatatgtctaacttttttttcttatgcttttgttttact |
20165484 |
T |
|
| Q |
227 |
ccataaagattttggttcagttccttgctatacacataagtgtttaagtcaattcaagtgtcattcacttaagcagattcttgttagaagggatataaat |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20165485 |
ccataaagattttggttcagttccttgctatacacataagtgtttaagtcaattcaagtgtcattcacttaagcagattcttgttagaagggatataaat |
20165584 |
T |
|
| Q |
327 |
gatgtcc |
333 |
Q |
| |
|
||||||| |
|
|
| T |
20165585 |
gatgtcc |
20165591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University