View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12351_high_7 (Length: 231)
Name: NF12351_high_7
Description: NF12351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12351_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 45378637 - 45378419
Alignment:
| Q |
5 |
ttatttattactactttgggtagatagtt-aattaatagatagatagatatgtattggttgaattgaatgattctgtgcagctattttgtcttatgc-gc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45378637 |
ttatttattactactttgggtagatagtttaattaatagatagatagatatgtattggttgaattgaatgattctgtgcagctattttgtcttatgctgc |
45378538 |
T |
 |
| Q |
103 |
catgactcgggcaatgttaggaatctacaagtactgttcatttttaaattctttcttgtttgtaatttttgactaaaggttcacacttcacacttcacac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45378537 |
catgactcgggcaatgttaggaatctacaagtactgtttatttttaaattctttcttgtttgtaatttttgactaaaggttcacacttctcacttcacac |
45378438 |
T |
 |
| Q |
203 |
taggaggaggcacaggttc |
221 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
45378437 |
tatgaggaggcacaggttc |
45378419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University