View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12351_low_6 (Length: 275)
Name: NF12351_low_6
Description: NF12351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12351_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 19 - 149
Target Start/End: Original strand, 38584775 - 38584905
Alignment:
| Q |
19 |
agaagcacaataacattagaagtgaccaagcaaatcataatcaactccataattgcaccgagaatagtatcaaacaccacaccacgtcgtatcaacaaaa |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584775 |
agaagcacaataacataagaagtgaccaagaaaatcagaatcaactccataattgcaccgagaatagtatcaaacaccacaccacgtcgtatcaacaaaa |
38584874 |
T |
|
| Q |
119 |
tcccaaactcattactacgtactattattaa |
149 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
38584875 |
tctcaaactcattactacgtactattattaa |
38584905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 147 - 262
Target Start/End: Original strand, 38587680 - 38587795
Alignment:
| Q |
147 |
taagtgaccaaacaaatgcatataccaaatacctttctagcgtgattgctactataaatcataacttccaaatctgtccccttgttgcaactttgatgac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38587680 |
taagtgaccaaacaaatgcatataccaaatacctttctagcgcgattgctactataaatcataacttccaaatctgtccccttgttgcaattttgatgac |
38587779 |
T |
|
| Q |
247 |
aattgccaaaccaact |
262 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38587780 |
aattgccaaaccaact |
38587795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 83 - 262
Target Start/End: Complemental strand, 21813116 - 21812942
Alignment:
| Q |
83 |
tagtatcaaacaccacaccacgtcgtatcaacaaaatcccaaactcattactacgtactattattaagtgaccaaacaaatgcatataccaaataccttt |
182 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||| |||||||||||||||| |||| | | ||||||||||||||||||||||||||||||||| |
|
|
| T |
21813116 |
tagtatcaaacaccacacagcgtcaaatca-caaaattccaaactcattactac----tattctcatgtgaccaaacaaatgcatataccaaataccttt |
21813022 |
T |
|
| Q |
183 |
ctagcgtgattgctactataaatcataacttccaaatctgtccccttgttgcaactttgatgacaattgccaaaccaact |
262 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||| ||||||||| |||||| ||||||||||| |||||||| |||| |
|
|
| T |
21813021 |
ctaacgtgattgctattataaatcataacttccaaatatgtccccttattgcaattttgatgacaaatgccaaactaact |
21812942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 21813388 - 21813321
Alignment:
| Q |
19 |
agaagcacaataacattagaagtgaccaagcaaatcataatcaactccataattgcaccgagaatagt |
86 |
Q |
| |
|
|||| |||| |||||| || |||||||||| ||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21813388 |
agaaccacactaacataagcagtgaccaagaaaatcataatcaattccataattgcatcgagaatagt |
21813321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University