View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12352_low_4 (Length: 313)
Name: NF12352_low_4
Description: NF12352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12352_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 27776376 - 27776618
Alignment:
| Q |
19 |
gcctctttaaacccattcccataaaccttcccaatggccaacaagacataactagtatttggggcaccatgcacctcacaaagactattactttatttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27776376 |
gcctctttaaacccattcccataaaccttcccaatggccaacaagacataactagtatttggggcaccatgcacctcacaaagactattactttatttga |
27776475 |
T |
 |
| Q |
119 |
tgttatatatgttcctcatttttctttcaaccttatttcagttattaagcttactaatcagtcaccatgttttgtttccttttatgatgatcattgtctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27776476 |
tgttatatatgttcctcatttttctttcaaccttatttcagttattaagcttactaatcagtcaccatgttttgtttccttttatgatgatcattgtctt |
27776575 |
T |
 |
| Q |
219 |
gtaaaggaaatgaatac---gaagatgattggcaaatctagag |
258 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
27776576 |
gtaaaggaaatgaataccttgaagatgattggcaaagctagag |
27776618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University