View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12352_low_6 (Length: 265)
Name: NF12352_low_6
Description: NF12352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12352_low_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 53462804 - 53463051
Alignment:
| Q |
18 |
acaaccggctcgtctgttacccggttgtaaccacgcttttcatctccaatgtgccgacacgtggctctccaaacaccctatgtgtcctctatgtagagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462804 |
acaaccggctcgtctgttacccggttgtaaccacgcttttcatctccaatgtgccgacacgtggctctccaaacaccctatgtgtcctctatgtagagca |
53462903 |
T |
 |
| Q |
118 |
aaacttgaccctcagagtctcaattctgagagtccctgctgaacgatcgatcaaaattcattggggcatgtttatatcagaataacatgaattactctga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53462904 |
aaacttgaccctcagagtctcaattctgagagtccctgctgaacgatcgatcaaaattcattggtgcatgtttatatcagaataacatgaattactctga |
53463003 |
T |
 |
| Q |
218 |
tcatcgttgcgatattaaacatgcacttcatgatattgttatacagtt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53463004 |
tcatcgttgcgatattaaacatgcacttcatgacattgttatacagtt |
53463051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University