View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12352_low_9 (Length: 239)
Name: NF12352_low_9
Description: NF12352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12352_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 53024465 - 53024682
Alignment:
| Q |
1 |
gaattgaaaccttgagggatgaagagttgcactcacagcttcttgaattgttgcaagggtaagtaaacattcggtcaaaatataaagtatcttttccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53024465 |
gaattgaaaccttgagggatgaagagttgcactcacagcttcttgaattgttgcaagggtaagtaaacattcggtcaaaatataaagtatcttt------ |
53024558 |
T |
|
| Q |
101 |
ttccccttcaaatttctaacacactgctaatattcctttgttatttttaacccatatcatcactcaatgtagcaccgacacttcatattgaaaacttctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53024559 |
-tccccttcaaatttctaacacactgctaatattcctttgttatttttaacccatatcatcactcaatgtagcaccgacacttcatattgaaaacttctt |
53024657 |
T |
|
| Q |
201 |
cagtgtctgacacgtattggaagtg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53024658 |
cagtgtctgacacgtattggaagtg |
53024682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 10794641 - 10794597
Alignment:
| Q |
169 |
gtagcaccgacacttcatattgaaaacttcttcagtgtctgacac |
213 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
10794641 |
gtagcaccgacacttcatattgaagacgtgttcagtgtctgacac |
10794597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 212
Target Start/End: Complemental strand, 10214993 - 10214945
Alignment:
| Q |
164 |
tcaatgtagcaccgacacttcatattgaaaacttcttcagtgtctgaca |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||| || ||| |||||| ||||| |
|
|
| T |
10214993 |
tcaatgtagcaccgacacttcaaattgaagacgtctacagtgtttgaca |
10214945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University