View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12354_low_12 (Length: 282)

Name: NF12354_low_12
Description: NF12354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12354_low_12
NF12354_low_12
[»] chr7 (1 HSPs)
chr7 (48-255)||(21113749-21113956)
[»] chr5 (1 HSPs)
chr5 (7-267)||(1160749-1161007)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 48 - 255
Target Start/End: Complemental strand, 21113956 - 21113749
Alignment:
48 tagcgcgttaaggagctgctgcctcctcttgttgttttttggtctagcggtgctggctgttcactggcagcgctgctgtcatgacagtccagcaccagtt 147  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21113956 tagcacgttaaggagctgctgcctcctcttgttgttttttggtctagcggtgctggctgttcactggcagcgctgctgtcatgacagtccagcaccagtt 21113857  T
148 gctgtgttgtgtagcctgttttgtgaagtaggtatggggtcttttgtggcaattttgctgggctgttggagggggtgctatggggttgaattttggtggt 247  Q
    |||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
21113856 gctgtgttgtgtagcctgttttgtgaggtaggtctggggtcttttgtggcaactttgctgggctgttggaggcggtgctatggggttgaattttggtggt 21113757  T
248 ttgaaatt 255  Q
    ||||||||    
21113756 ttgaaatt 21113749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 7 - 267
Target Start/End: Original strand, 1160749 - 1161007
Alignment:
7 gtgtatgttttatgagtggagttggagtccacataattgcttagcgcgttaaggagctgctgcctcctcttgttgttttttggtctagcggtgctggctg 106  Q
    |||||||||||||||||||||||||||||| |   |||||||||| |||||| ||||||||||||||| ||||  |||||||||| || |||| ||||||    
1160749 gtgtatgttttatgagtggagttggagtccgcgggattgcttagcacgttaatgagctgctgcctccttttgt--ttttttggtccagtggtgttggctg 1160846  T
107 ttcactggcagcgctgctgtcatgacagtccagcaccagttgctgtgttgtgtagcctgttttgtgaagtaggtatggggtcttttgtggcaattttgct 206  Q
     |||||||||||| |||||||||||||||||||||    ||| ||||| |||||||| ||||| ||| | |||| |||  ||||| ||||||  ||||||    
1160847 ctcactggcagcgatgctgtcatgacagtccagcaagttttgttgtgtcgtgtagccggttttttgaggaaggtctggcctctttggtggcagctttgct 1160946  T
207 gggctgttggagggggtgctatggggttgaattttggtggtttgaaattggatttcagagc 267  Q
    || || ||||||| ||||||| |||||||||||||| |||||   ||||||||||||||||    
1160947 ggtctattggaggcggtgctaaggggttgaattttgatggttcataattggatttcagagc 1161007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University