View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12354_low_5 (Length: 442)
Name: NF12354_low_5
Description: NF12354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12354_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 18 - 428
Target Start/End: Complemental strand, 43909048 - 43908638
Alignment:
| Q |
18 |
aagtagctctatcatttgcttgtaatgtatccatcctacttgattctctttgaggaagagattttcttctccaagttttagcaacaggtgaacttgattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43909048 |
aagtagctctatcatttgcttgtaatgtatccatcctacttgattctctttgaggaagagattttcttctccaagttttagcaacaggtgaacttgattt |
43908949 |
T |
|
| Q |
118 |
ttcataccttctattttgatcctttacatgttcttttcccatgccaggttcattaggagtttgtttcttaacgtatcgcattaaaagtccatctaatatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43908948 |
ttcataccttctattttgatcctttacatgttcttttcccatgccaggttcattaggagtttgtttgttaacgtatcgcattaaaagtccatctaatatc |
43908849 |
T |
|
| Q |
218 |
atttcttcatccaatgcaccacctgtttcagaaaaatctttaactgtgttttcaacaggtggtggttttagaggtctccttctcactgatcttggtttcg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43908848 |
atttcttcatccaatgcaccacctgtttcagaaaaatctttaactgtgttttcaacaggtggtggttttagaggtctccttctcactgatcttggtttcg |
43908749 |
T |
|
| Q |
318 |
gcttttcagcaggtagagcttcaactgttttcttcatattgctttcgactttaacttctttgacataaggaggtggaacatgcttattggaaaatggttt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43908748 |
gcttttcagcaggtagagcttcaactgttttcttcatattgctttcgactttaacttctttgacataaggaggtggaacatgcttattggaaaatggttt |
43908649 |
T |
|
| Q |
418 |
cttagtctctg |
428 |
Q |
| |
|
|||||| |||| |
|
|
| T |
43908648 |
cttagtttctg |
43908638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University