View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12355_low_11 (Length: 227)
Name: NF12355_low_11
Description: NF12355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12355_low_11 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 13873075 - 13873290
Alignment:
| Q |
1 |
aggaaaaaagatgtgagaggtattatcatcttttctcacatgtcttggttcattaagggaaaaatagtcattttgggtggaaaatgctaagtcatcaagg |
100 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13873075 |
aggaaaaaagaagtcaggggtattatcatcttttctcacatgtcttggttcattaagggaaaaatagtcattttggttggaaaatgctaagtcatcaagg |
13873174 |
T |
 |
| Q |
101 |
ttttatcccaggttctatcccagccagattgtgccacgtcagtaatcacatgccgcataagtaat-agatgtaattaggatcaaaattcggatgattata |
199 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13873175 |
tt------------ctatcccagctagattgtgccacgtcagtaatcacatgccgcataagtaattagatgtaattaggatcaaaattcggatgattata |
13873262 |
T |
 |
| Q |
200 |
ttgcagggcaattttggaaggattagta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13873263 |
ttgcagggcaattttggaaggattagta |
13873290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 13872636 - 13872574
Alignment:
| Q |
49 |
ttcattaagggaaaaatagtcattttgggtggaaaatgctaagtcatcaaggttttatcccag |
111 |
Q |
| |
|
||||||||||| || | || ||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
13872636 |
ttcattaagggtgaagtggttattttgggtggaaaatgttgagtcgtcaaggttttatcccag |
13872574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University