View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_high_13 (Length: 396)
Name: NF12356_high_13
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 348; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 18 - 381
Target Start/End: Complemental strand, 36873410 - 36873047
Alignment:
| Q |
18 |
aacatcactcaacagaataaaaaatggacaataaggtttttaccccattgcctttgtttgaaggcacattattattatccattagcgcctgccgcttaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36873410 |
aacatcactcaacagaataaaaaatggacaataaggtttttaccccattgcctttgtttgaaggcacattattattatccattagcgcctgccgcttaat |
36873311 |
T |
 |
| Q |
118 |
cttgctcaccatctttttccaattggtaaccaatcgatcgagttcccagagagtctccgtgtcaacagcctccatatcaagctcaatctcatccccatct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36873310 |
cttgctcaccatctttttccaattggtaaccaatcgatcgagttcccagagagtctccgtgtcaacagcctccatatcaagctcaatctcatccccatct |
36873211 |
T |
 |
| Q |
218 |
tgctccagatgcccatttctcttccttatgatctgtactacttgttccatcttctctggtggcaaaatctgcagcccaagtcccaacttgtgcttttctt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
36873210 |
tgctccagatgcccatttctcttccttatgatctgtaccacttgttccatcttctctggtggcaaaatctgcaacccaagccccaatttgtgcttttctt |
36873111 |
T |
 |
| Q |
318 |
cgacattcatttccctcttatttggatccctggcctttggcttgggctgcttcaagggcttcac |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36873110 |
cgacattcatttccctcttatttggatccctggcctttggcttgggctgcttcaagggcttcac |
36873047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 18 - 381
Target Start/End: Complemental strand, 36863054 - 36862689
Alignment:
| Q |
18 |
aacatcactcaacagaa-taaaaaatggacaataaggtttttaccccattgcctttgtttgaaggcacattattattatccattagcgcctgccgcttaa |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36863054 |
aacatcactcaacagaaataaaaaatggacaataaggtttttaccccattgcctttgtttgaaggcacattattattatccattagcgcctgccgcttaa |
36862955 |
T |
 |
| Q |
117 |
tcttgctcaccatctttttccaattggtaaccaatcgatcgagttcccagagagtctccgtgtcaacagcctccatatcaagctcaatctcatccccatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36862954 |
tcttgctcaccatctttttccaattggtaaccaatcgatcgagttcccagagagtctccgtgtcaacagcctccatatcaagctcaatctcatccccatc |
36862855 |
T |
 |
| Q |
217 |
ttgctccagatgcccatttctcttccttatgatctgtactacttgttccatcttctctggtggc-aaaatctgcagcccaagtcccaacttgtgcttttc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36862854 |
ttgctccagatgcccatttctcttccttatgatctgtactacttgttccatcttctctggtggcaaaaatctgcagcccaagtcccaacttgtgcttttc |
36862755 |
T |
 |
| Q |
316 |
ttcgacattcatttccctcttatttggatccctggcctttggcttgggctgcttcaagggcttcac |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36862754 |
ttcgacattcatttccctcttatttggatccctggcctttggcttgggttgcttcaagggcttcac |
36862689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University