View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_high_17 (Length: 377)
Name: NF12356_high_17
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 224 - 361
Target Start/End: Original strand, 16300388 - 16300525
Alignment:
| Q |
224 |
atagatcctggcactcctactgtccctacaccacctttccttccttccccatctcctttccctggaacttgcaagtaagttgctttcaaaacacaacaca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16300388 |
atagatcctggcactcctactgtccctacaccacctttccttccttccccatctccattccctggaacttgcaagtaagttgctttcaaaacacaacaca |
16300487 |
T |
|
| Q |
324 |
ttgttaaggtttttatttttgttgacaaaagtacattg |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16300488 |
ttgttaaggtttttatttttgttgacaaaagcacattg |
16300525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 16300189 - 16300325
Alignment:
| Q |
19 |
agggtattatacaccaacaccaccttcaactggatgtggatattcaccaccacatgatccttctacaccatcaacaccatcacataatccaacaccttca |
118 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
16300189 |
agggtattatacaccaacaccaccttctactggatgtggatattcaccaccacatgatccttctaca---tcaacaccatcacataatcaaacaccttca |
16300285 |
T |
|
| Q |
119 |
acaccatcaaaccctccatcaagtggtggatactataact |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16300286 |
acaccatcaaaccctccatcaagtggtggatactataact |
16300325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University