View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_high_28 (Length: 294)
Name: NF12356_high_28
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_high_28 |
 | |
|
| [»] scaffold0140 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 45 - 206
Target Start/End: Complemental strand, 36900 - 36735
Alignment:
| Q |
45 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcaatatgatgcttatgttgaaactgtaa-tttggttagc-acc--nnnnnnn |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
36900 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcactatgatgcttatgttgaaactgtaattttggttagctaccttttttttt |
36801 |
T |
|
| Q |
141 |
nggatgttttggtgctattggacctgttatgttatgttttggtacattatgatgtttgtaatgacc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36800 |
tggatgttttggtgctattggacctgttatgttatgttttggtacattatgatgttggtaatgacc |
36735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 179 - 274
Target Start/End: Complemental strand, 36707 - 36612
Alignment:
| Q |
179 |
ttggtacattatgatgtttgtaatgaccattttggtgttatgtcttggtacgttatggtgttagtaatgaccattttggtccattttggtatgaaa |
274 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
36707 |
ttggtacattatggtgtttgtaatgaccattttggtgttatgtcttggtacattatggtgttagtaatgaccattttggtgcattttgctatgaaa |
36612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 36672 - 36627
Alignment:
| Q |
170 |
tgttatgttttggtacattatgatgtttgtaatgaccattttggtg |
215 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
36672 |
tgttatgtcttggtacattatggtgttagtaatgaccattttggtg |
36627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University