View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_high_29 (Length: 285)
Name: NF12356_high_29
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 16815079 - 16815332
Alignment:
| Q |
13 |
ctgtggttcatcaaatagcttcagggttagaagctgttcataaagctaatatagttcatagagatttgaaacctgaaaattgtcnnnnnnnagatgttag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16815079 |
ctgtggttcatcaaatagcttcagggttagaagctgttcatagagctaatatagttcatagagatttgaaacctgaaaattgtctttttttagatgttag |
16815178 |
T |
 |
| Q |
113 |
gaaagattctcctcttaagattatggattttgggttgagttctgttgaagagtttactgatcctgttgttggtttgtttggatctattgattatgtttca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16815179 |
gaaagattctcctcttaagattatggattttgggttgagttctgttgaagagtttactgatcctgttgttggtttgtttggatctattgattatgtttca |
16815278 |
T |
 |
| Q |
213 |
cctgaggctctttctcaaggaaagattactacaaagagtgatatgtggtctctt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16815279 |
cctgaggctctttctcaaggaaagattactactaagagtgatatgtggtctctt |
16815332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University