View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_low_12 (Length: 414)
Name: NF12356_low_12
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 96 - 404
Target Start/End: Complemental strand, 2528838 - 2528530
Alignment:
| Q |
96 |
ttgttcaaatcaaaggggttttggtgtagaaatttcaaagggtcttttgtggtttttgaatgtagggtttaggatttcacaattggaattcagttgagat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528838 |
ttgttcaaatcaaaggggttttggtgtagaaatttcaaagggtcttttgtggtttttgaatgtagggtttaggatttcacaattggaattcagttgagat |
2528739 |
T |
 |
| Q |
196 |
ttgtgagtgtctttgagcctgcatgcaagggatcagttttctgaattttgcttttgtatgtatatgcagagaaatggaagaattttgttaatttctctat |
295 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528738 |
ttgtgagtgtctctgagcctgcatgcaagggatcagttttctgaattttgcttttgtatgtatatgcagagaaatggaagaattttgttaatttctctat |
2528639 |
T |
 |
| Q |
296 |
gagaaacatgatgatttttaatttcataaatattttaccagcttgattgaatgaattttttgtctgacatgtttgttttgtttcattttcctgtctgatt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528638 |
gagaaacatgatgatttttaatttcataaatattttaccagcttgattgaatcaattttttgtctgacatgtttgttttgtttcattttcctgtctgatt |
2528539 |
T |
 |
| Q |
396 |
tgttctctg |
404 |
Q |
| |
|
||||||||| |
|
|
| T |
2528538 |
tgttctctg |
2528530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 2528911 - 2528883
Alignment:
| Q |
18 |
cttttttcatcaacttttctaaaaatttg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2528911 |
cttttttcatcaacttttctaaaaatttg |
2528883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University