View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_low_25 (Length: 324)
Name: NF12356_low_25
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 313
Target Start/End: Original strand, 46731690 - 46731978
Alignment:
| Q |
18 |
agggctaaggtgggtagagaaatagtagtatattcaatatttatattgatatgatatgattaatagtatttcacttttgttaattattataagcataggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731690 |
agggctaaggtgggtagagaaatagtagtatattcaatatttatattcatatgatatgattaatagtatttcacttttgttaattattataagcataggc |
46731789 |
T |
 |
| Q |
118 |
ataacatcatcaatagttgtaatattttgtctatattatctgtgcaatgtgcatactgaatgataatagaaccaaaaaaggtacggatattttgccttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731790 |
ataacatcatcaatagttgtaatattttgtctatattatctgtg-------catactgaatgataatagaaccaaaaaaggtacggatattttgccttat |
46731882 |
T |
 |
| Q |
218 |
gtctttgattgtcatatatcacttctactggcagaggttgttatctttgtgcactccaaaacaaatctgaccctctgccgtgccgtgctgttctgt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731883 |
gtctttgattgtcatatatcacttctactggcagaggttgttatctttgtgcactccaaaacaaatctgaccctctgccgtgccgtgctgttctgt |
46731978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University