View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_low_39 (Length: 241)
Name: NF12356_low_39
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_low_39 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 33780574 - 33780352
Alignment:
| Q |
19 |
acaatagcagccacatcaacctaatttgatcccaatttttcttataccaatcaagcatagtgacgtggctgcaacaacgatttaaaccttggatattgct |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780574 |
acaatagcagccacatcaacctgatttgatcccaatttttcttataccaatcaagcatagtgacgtggctgcaacaacgatttaaaccttggatattgct |
33780475 |
T |
 |
| Q |
119 |
tcctagtcccttttaggttgaaaacggcatattgtatttattttaaccaccttgattgttcatttggaatcaacttgtgcagagtgtattatgattaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33780474 |
tcctagtcccttttaggttgaaaacggcatattgtatttattttaaccaccttgattgttcatttgaaatcaacttgtgcagagtgtattatgattaata |
33780375 |
T |
 |
| Q |
219 |
tttcagtctaaaggaaaagaact |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33780374 |
tttcagtctaaaggaaaagaact |
33780352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University