View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12356_low_44 (Length: 227)
Name: NF12356_low_44
Description: NF12356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12356_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 12 - 208
Target Start/End: Original strand, 41931451 - 41931643
Alignment:
| Q |
12 |
cctgtgacatacattaaaaaactcgaatgagcaatccatccacaaaatatcgataaaacaatcgtaaaacataacctcctcttgtcatttctggactgag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41931451 |
cctgtgacatacattaaaaaactcgaatgagcaatccaaccacaaaatatcgataagacaatcgtaaaacataacttcctcttgtcatttctggactgag |
41931550 |
T |
|
| Q |
112 |
tgttagaaacaaaacttgcaatgcaagaagtgtatctagaaggagctttttcatgacaaatttgcaacagataggaggaaaaatagtaataataacc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41931551 |
tgttagaaacaaaacttgcaatgcaagaagtgtatcca----gagctttttcatgacaaatttgcaacagataggaggaaaaatagtaataataacc |
41931643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University