View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12357_high_3 (Length: 344)
Name: NF12357_high_3
Description: NF12357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12357_high_3 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 173 - 344
Target Start/End: Original strand, 13019970 - 13020141
Alignment:
| Q |
173 |
ctgtacgtgtgatttagaaatacgcatcctatgatgataaacgtttttggaccacattgttatgagttgttcagtcaaacgacaagaaatatgcctctga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13019970 |
ctgtacgtgtgatttagaaatacgcatcctatgatgataaacgtttttggaccacattgttatgagttgttcagtcaaacgacaagaaatatgcctctga |
13020069 |
T |
 |
| Q |
273 |
attatcgtaactcatgatgtcaaactgttcataactacaataatatccagacaaaagaaatctatctctgct |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13020070 |
attatcgtaactcatgatgtcaaactgttcataactacaataatatccagacaaaagaaatctatctctgct |
13020141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13019798 - 13019844
Alignment:
| Q |
1 |
ttttaattttaaacatcttatcaagtgcctcaagagtatttattagc |
47 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13019798 |
ttttaattttaaacatgttatcaagtgcctcaagagtatttattagc |
13019844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University