View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_13 (Length: 263)
Name: NF12358_high_13
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 247
Target Start/End: Complemental strand, 4042779 - 4042548
Alignment:
| Q |
16 |
tgtggccttaacatccatgnnnnnnnatgtctttgtgagcaaattaatgcaggcattagttgtatttgactgcgattttccataatatgatgcaattata |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4042779 |
tgtggccttaacatccatgtttttttatgtctttgtgagcaaattaatgcaggcattagttgtatttgactgtgattttccataatatgatgcaattata |
4042680 |
T |
 |
| Q |
116 |
gcgtaattgcgaccacaatttaaaattaagattaatttatgtatgaaagacatgtgtgtgtctagatgcagaagctattttcacaattatgaatattgac |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4042679 |
gcataattgcgaccacaatttaaaattaagattaatttatgtatgaaagacatgtgtgtgtctagatgcagaagctattttcacaattatgaatattgac |
4042580 |
T |
 |
| Q |
216 |
tctaataattaattaatgaatttggatcttat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4042579 |
tctaataattaattaatgaatttggatcttat |
4042548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University