View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_15 (Length: 258)
Name: NF12358_high_15
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 119 - 243
Target Start/End: Original strand, 9540377 - 9540501
Alignment:
| Q |
119 |
taacgtaagttacatagttttatgatggcattcgtgcacattctttcaactgttgggtttattttccttttctaagtttgaagaccatagtttttgtttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9540377 |
taacgtaagttacatagttttatgatggcatttgtgcacattctttcaactgttgggtttattttccttttctaagtttgaagaccatagtttttgtttt |
9540476 |
T |
|
| Q |
219 |
gataagcatgccgttgtagttacac |
243 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
9540477 |
gataagcacgccgttgtagttacac |
9540501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University