View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_18 (Length: 236)
Name: NF12358_high_18
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_18 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 92480 - 92269
Alignment:
| Q |
13 |
agcagagaaaatacacaattccaaatagagaagttaatatatgccatgcaactaattaatcacattcggaacaaaacttaaagagacctatttcagttgc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
92480 |
agcagagaaaatacacaattccaaatagagaagttcatatatgccatgcaactaattaatcacattatgaacaaaacttaaagagacctatttcagttgc |
92381 |
T |
 |
| Q |
113 |
tataaatgnnnnnnntaaatatgcatggatgattaactagtaagtgcaaaatgagcaaatttgaggggtcaaaatcactcattttaaactt-ggagaaac |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
92380 |
tataaatgaaaaaaataaatatgcatggatgattaactagtaagtgcaaaatgagcaaatttgaggggtcaaaatcactcattttaaacttgggagaaac |
92281 |
T |
 |
| Q |
212 |
caaaatcatata |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
92280 |
caaaatcatata |
92269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 209
Target Start/End: Complemental strand, 30433363 - 30433327
Alignment:
| Q |
173 |
ttgaggggtcaaaatcactcattttaaacttggagaa |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30433363 |
ttgaggggttcaaatcactcattttaaacttggagaa |
30433327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University