View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_19 (Length: 234)
Name: NF12358_high_19
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 36807278 - 36807482
Alignment:
| Q |
18 |
gattttacgagtgtatctctctaactgtcgaatattgagaaataatagagatctagtcaaaagatcaacaaaataatcatctactaacttggtgtgacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36807278 |
gattttacgagtgtatctctctaactgtcgaatattgagaaataatagagatctagccaaaagatcaacaaaataatcatctactaacttggtgtgacaa |
36807377 |
T |
|
| Q |
118 |
gtgtgaaaatgcggtgtcttgctcgcttgtgcagtttatgttaatccatcatgatgattctccgatgttttaggctccccatatgatcaataatggtata |
217 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36807378 |
gtgtgaaaatgtgatatcttgctcgcttgtgcagtttaagttaatccatgatgatgattccccgatgttttaggctccccatatgatcaataatggtata |
36807477 |
T |
|
| Q |
218 |
agagc |
222 |
Q |
| |
|
||||| |
|
|
| T |
36807478 |
agagc |
36807482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University