View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_21 (Length: 221)
Name: NF12358_high_21
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_21 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 62 - 221
Target Start/End: Complemental strand, 7153925 - 7153766
Alignment:
| Q |
62 |
atctcgattaccccttatatatgttttaaaatcgacaagtttttacaattcatgtgtatgatggattttattgccttgcagatgcaacagcaggtctagt |
161 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153925 |
atctcgaataccccttatatatattttaaaatcgacaagtttttacaattcatgtgtatgatggattttattgccttgcagatgcaacagcaggtctagt |
7153826 |
T |
 |
| Q |
162 |
gggttgggctatctcgaaggcgaaaccacagaaaccgtgattctgggcgttgctccggca |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7153825 |
gggttgggctatctcgaaggtgaaaccacagaaaccgtgattatgggcgttgctccggca |
7153766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 220
Target Start/End: Complemental strand, 7159945 - 7159864
Alignment:
| Q |
139 |
gcagatgcaacagcaggtctagtgggttgggctatctcgaaggcgaaaccacagaaaccgtgattctgggcgttgctccggc |
220 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||| |||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
7159945 |
gcagatgcaacaagaggtctagtggattgaactatgccgaaggcgaaaccacagaaaccgtgattttgggcgttggtccggc |
7159864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University