View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_6 (Length: 357)
Name: NF12358_high_6
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 110 - 343
Target Start/End: Complemental strand, 31788613 - 31788381
Alignment:
| Q |
110 |
acttcacgttattttttgtttgtgaagaagaaattataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788613 |
acttcacgttattttttgtttgtgaagaagaa-ttataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa |
31788515 |
T |
 |
| Q |
210 |
cccattgactagtcaaggccaagttgatcaatatggcaatcccattagtggtggtgggatgaccggggctactggtcatggtcatggacatcatcaacaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31788514 |
cccattgactagtcaaggccaagttgatcaatatggcaatcccattagtggtggtgggatgaccggtgctactggtcatggtcatggacatcatcaacaa |
31788415 |
T |
 |
| Q |
310 |
catcatggagttggagttgatcaaaccacaggtt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31788414 |
catcatggagttggagttgatcaaaccacaggtt |
31788381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University