View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_high_7 (Length: 355)
Name: NF12358_high_7
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 195 - 342
Target Start/End: Original strand, 55208461 - 55208608
Alignment:
| Q |
195 |
gatctgaatgaatatgtcaactgatgctcatttccttcaggtgaaccaaaacatgccaactcttcattctgatcatgtctatgccaacactaagtataac |
294 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208461 |
gatctgaatgaatatgtcaattgatgctcatttccttcaggtgaaccaaaacatgccaactcttcattctgatcatgtctatgccaacactaagtataac |
55208560 |
T |
 |
| Q |
295 |
aacaatcaacagagggacgaggttgatcgctttttaatatcacaggtt |
342 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55208561 |
aacaatcaacagagcgacgaggttgatcgctttttaatatcacaggtt |
55208608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 21 - 146
Target Start/End: Original strand, 55208287 - 55208415
Alignment:
| Q |
21 |
attgccagccacaaacaaacaaaactctctgattcttgctcatgacccgccgttaaaccctcaaactaattaaactcctt---ttattattattattgta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55208287 |
attgccagccacaaacaaacaaaactctctgattcttgctcatgacccgccgttagaccctcaaactaattaaactccttttattattattattattgta |
55208386 |
T |
 |
| Q |
118 |
cgttataatatatgtgggttgagaaacgc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55208387 |
cgttataatatatgtgggttgagaaacgc |
55208415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University