View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12358_high_9 (Length: 307)

Name: NF12358_high_9
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12358_high_9
NF12358_high_9
[»] chr8 (1 HSPs)
chr8 (15-267)||(2777785-2778037)


Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 15 - 267
Target Start/End: Complemental strand, 2778037 - 2777785
Alignment:
15 agaacctgtgcagaatacgaaaaaagtagttagaatcagtttgaaggtaagaaaacgatttgaattgaaaaatactcggaggaggagtgaaagtgatatt 114  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
2778037 agaacctgtgcacaatacgaaaaaagtagttagaatcagtttgaaggtaagaaaacgatttgaattgaaaaatactcggaggaggagtgaaagtgatatc 2777938  T
115 gattgagattaagaagataaaagagaattgaagtgtaattaataacgcaaaattgagaatagagaaaacctgatctttatccagtttggcgggggatgcc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2777937 gattgagattaagaagataaaagagaattgaagtgtaattaataacgcaaaattgagaatagagaaaacctgatctttatccagtttggcgggggatgcc 2777838  T
215 atggtcgttggtgaagaagactgagggagaggacggacccaaaatggggatgg 267  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
2777837 atggtcgttggtgaagaagactgagggagaggaaggacccaaaatggggatgg 2777785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University