View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_low_18 (Length: 236)
Name: NF12358_low_18
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 23 - 223
Target Start/End: Complemental strand, 9378780 - 9378580
Alignment:
| Q |
23 |
tgtgtttgtgtttgtgtctttgccttgtgatgatatgcatgtatctatatatattggctttaagttatttgagttcttatcatgaggggaagattaaact |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9378780 |
tgtgtttgtgtttgtgtctttgccttgtgatgatatgcatgtatctatatatattggctttaagttatttgagttcttatcatgaggggaagattaaact |
9378681 |
T |
|
| Q |
123 |
catcaattgctagctttatatccaaaacttattggtcctgctacacaattttcttccacctgtgcattgtgaatattacctatttttcctttttctcatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9378680 |
catcaattgctagctttatatccaaaacttattggtcctgctacacaattttcttccacctgtgcattgtgaatattacctatttttcctttttcccatc |
9378581 |
T |
|
| Q |
223 |
t |
223 |
Q |
| |
|
| |
|
|
| T |
9378580 |
t |
9378580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 92 - 161
Target Start/End: Complemental strand, 8185779 - 8185709
Alignment:
| Q |
92 |
tgagttcttatcatgaggggaagattaaactca-tcaattgctagctttatatccaaaacttattggtcct |
161 |
Q |
| |
|
|||||||||||||||||| ||||| ||| | ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8185779 |
tgagttcttatcatgaggatcagatttaaccccctcaattgctagctttatatccaaaactcattggtcct |
8185709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University