View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12358_low_23 (Length: 214)
Name: NF12358_low_23
Description: NF12358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12358_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 45168101 - 45167909
Alignment:
| Q |
16 |
agaggatggtgattttaacgttgttgaatgtttttgagatctgacgaccacgacggtttttgctgttggagtttgttgctgtggttggtaaaactgcgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45168101 |
agaggatggtgattttaacgttgttgaatgtttttgagatctgacgaccacgacggtttttgctgttggagtttgttgctgtggttggtaaaactgcgct |
45168002 |
T |
|
| Q |
116 |
gctgcttctgttgtgaagtgaaccattttcttttcccatgttttctgtcactcact------ctcagtgagaaatgagtatatggaatttgat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45168001 |
gctgcttctgttgtgaagtgaaccattttcttttcccatgttttctgtcactcactctcactctcagtgagaaatgagtatatggaatttgat |
45167909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University