View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12358_low_9 (Length: 315)

Name: NF12358_low_9

Description: NF12358

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF12358_low_9

[»] chr5 (2 HSPs)

Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 2)

Name: chr5

Description:

Target: chr5; HSP #1

Raw Score: 142; E-Value: 2e-74

Query Start/End: Original strand, 18 - 159

Target Start/End: Complemental strand, 28053816 - 28053675

Alignment:

Q	18	aagggaggcttcgttatctagattgtcgagtggaagcagttacgcgacgagtttgtttgcttcagatgttaccgttactgctacattctcaagtgatgat	117	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	28053816	aagggaggcttcgttatctagattgtcgagtggaagcagttacgcgacgagtttgtttgcttcagatgttaccgttactgctacattctcaagtgatgat	28053717	T

Q	118	attacaaaagaagatacgtcgtcgtttcgagtttctactaat	159	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	28053716	attacaaaagaagatacgtcgtcgtttcgagtttctactaat	28053675	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2

Raw Score: 76; E-Value: 4e-35

Query Start/End: Original strand, 235 - 310

Target Start/End: Complemental strand, 28053599 - 28053524

Alignment:

Q	235	tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg	310	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	28053599	tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg	28053524	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]