View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12359_high_2 (Length: 317)
Name: NF12359_high_2
Description: NF12359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12359_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 26 - 154
Target Start/End: Complemental strand, 29631766 - 29631638
Alignment:
| Q |
26 |
ggagattgcatcccgagtttatcgcaaccccgcaccatccattccgagagtccgagatctgaaaacgacgtgtgtttgtcgtttccagcgttatcacagt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29631766 |
ggagattgcatcccgagtttatcgcaaccccgcaccatccattccgagagtcctagatctgaaaacgacatgtgtttgtcgtttccagcgttatcacagt |
29631667 |
T |
|
| Q |
126 |
ccgttgtattgcaatagctagctgctgag |
154 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
29631666 |
ccgttgtattacaatagctagctgctgag |
29631638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 190 - 302
Target Start/End: Complemental strand, 29631603 - 29631491
Alignment:
| Q |
190 |
gaagtaagctgttacggttgaccaggaaggaagaaagggaaaggagagagtgcgactcactggttatgggagaaatccatgtgcggctgccaggtttaga |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29631603 |
gaagtaagctgttacggttgaccaggaaggaagaaagggaaaggagagagtgcgactcactggttatgggagaaatccatgtgcggctgccaggtttaga |
29631504 |
T |
|
| Q |
290 |
atccatttcacag |
302 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29631503 |
atccatttcacag |
29631491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 91
Target Start/End: Original strand, 28390248 - 28390281
Alignment:
| Q |
58 |
caccatccattccgagagtccgagatctgaaaac |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
28390248 |
caccatccattctgagagtccgagatctgaaaac |
28390281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University