View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12359_high_3 (Length: 276)

Name: NF12359_high_3
Description: NF12359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12359_high_3
NF12359_high_3
[»] chr1 (2 HSPs)
chr1 (114-261)||(46985327-46985474)
chr1 (1-46)||(46985542-46985587)


Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 114 - 261
Target Start/End: Complemental strand, 46985474 - 46985327
Alignment:
114 caggtgctagaattggagagatgaaaagggtcaccaaggaaactaatgtatcagtcaaaattaacttggatggaactgggtttgctgataacagttctgg 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
46985474 caggtgctagaattggagagatgaaaagggtcaccaaggaaactaatgtatcagtcaaaattaacttggatggaactggggttgctgataacagttctgg 46985375  T
214 aattccctttcttgatcttatgctttatgttagttttttcaactcaat 261  Q
    ||||||||||||||||| ||||||| |||||||| |||||||||||||    
46985374 aattccctttcttgatcatatgcttgatgttagtgttttcaactcaat 46985327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 46985587 - 46985542
Alignment:
1 cttcttcaactttcccaattgactcaggtttttcttgttatgaggg 46  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
46985587 cttcttcaactttcccaattgactcaggtttttcttgttatgaggg 46985542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University