View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12359_low_4 (Length: 276)
Name: NF12359_low_4
Description: NF12359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12359_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 114 - 261
Target Start/End: Complemental strand, 46985474 - 46985327
Alignment:
| Q |
114 |
caggtgctagaattggagagatgaaaagggtcaccaaggaaactaatgtatcagtcaaaattaacttggatggaactgggtttgctgataacagttctgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46985474 |
caggtgctagaattggagagatgaaaagggtcaccaaggaaactaatgtatcagtcaaaattaacttggatggaactggggttgctgataacagttctgg |
46985375 |
T |
|
| Q |
214 |
aattccctttcttgatcttatgctttatgttagttttttcaactcaat |
261 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
46985374 |
aattccctttcttgatcatatgcttgatgttagtgttttcaactcaat |
46985327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 46985587 - 46985542
Alignment:
| Q |
1 |
cttcttcaactttcccaattgactcaggtttttcttgttatgaggg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46985587 |
cttcttcaactttcccaattgactcaggtttttcttgttatgaggg |
46985542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University