View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12360_high_17 (Length: 215)

Name: NF12360_high_17
Description: NF12360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12360_high_17
NF12360_high_17
[»] chr5 (1 HSPs)
chr5 (16-196)||(2925083-2925263)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 2925263 - 2925083
Alignment:
16 gttctgatagggttggtagtgggaatttcagttcaagagaaggttctcgttctgctgtttctggttctagttatgtttcattggcgcaatttgatgaaga 115  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2925263 gttctgataggattggtagtgggaatttcagttcaagagaaggttctcgttctgctgtttctggttctagttatgtttcattggcgcaatttgatgaaga 2925164  T
116 gagtactaggtgaattttctgaaccttttattgtatttaattctgagttatttggtgaatattttgatatcttgttcttat 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
2925163 gagtactaggtgaattttctgaaccttttattgtatttaattctgagttatttggtgaatattttgatatctcgttcttat 2925083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University