View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12360_high_6 (Length: 386)
Name: NF12360_high_6
Description: NF12360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12360_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 129 - 380
Target Start/End: Complemental strand, 43759974 - 43759723
Alignment:
| Q |
129 |
aattgtaattgagatagggatgaagagtgaaagaaggaggaaccttgcgtgagtcattgggctgcatttggagttgaaggttagaagagcttcgaacaac |
228 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43759974 |
aattgtaattgagatagggataaagagtgaaagaaggaggaaccttgcgtgagtcattgggctgcatttggagttgaaggttagaagagcttcgaaccac |
43759875 |
T |
|
| Q |
229 |
aaatttggttccaagggaaagtgatgaagcaaggcgaggaagagtggtggctgttgggtacacacgaactagcgccattcaatttagtgtcagtttcttg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43759874 |
aaatttggttccaagggaaagtgatgaagcaaggcgaggaagagtggtggctgttgggtacacacgaactagcgccattcaatttagtgtcagtttcttg |
43759775 |
T |
|
| Q |
329 |
tttcttccaaccctgtctgtctctctatccacacccaccgcatctgtgctcc |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43759774 |
tttcttccaaccctgtctgtctctctatccacacccaccgcatctgtgctcc |
43759723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 43760109 - 43760006
Alignment:
| Q |
18 |
ggaagactatagtattctttttcaagcttgtccttcacttccagaattaactacaaaatatcaacaaacaaaaaagtaatcacattttgatatacccttt |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760109 |
ggaagactataatattctttttcaagcttgtccttcacttccagaattaactaaaaaatatgaacaaacaaaaaagtaatcacattttgatatacccttt |
43760010 |
T |
|
| Q |
118 |
taga |
121 |
Q |
| |
|
|||| |
|
|
| T |
43760009 |
taga |
43760006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 151 - 278
Target Start/End: Complemental strand, 43755282 - 43755158
Alignment:
| Q |
151 |
aagagtgaaagaaggaggaaccttgcgtgagtcattgggctgcatttggagttgaaggttagaagagcttcgaacaacaaatttggttccaagggaaagt |
250 |
Q |
| |
|
||||||||||||| || ||||||| | ||||||||||| || |||||| |||||||| | ||| ||||| || |||||||||| |||||||| | |
|
|
| T |
43755282 |
aagagtgaaagaaagaagaaccttttgggagtcattgggttgactttggaactgaaggttgca---gctccgaactacgaatttggttcgaagggaaatt |
43755186 |
T |
|
| Q |
251 |
gatgaagcaaggcgaggaagagtggtgg |
278 |
Q |
| |
|
| ||||| ||| |||||||||||||||| |
|
|
| T |
43755185 |
gttgaagaaagacgaggaagagtggtgg |
43755158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University