View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12360_low_10 (Length: 297)
Name: NF12360_low_10
Description: NF12360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12360_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 28381730 - 28381472
Alignment:
| Q |
1 |
aatattttgaatataaaggcattcattcattattcnnnnnnntatatcattcatttaattttctgttttgaaaatagtgctgcttgaaatggtttannnn |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381730 |
aatatcttgaatataaaggcattcattcattattcaaaaaaagatatcattcatttaattttctgttttgaaaatagtgctgcttgaaatggttt-tttt |
28381632 |
T |
 |
| Q |
101 |
nnnnnnnnnggtatgatatggaatattggtgttaaagaacattgttttgattcttgttgatagatgaatattcggaaggattttgaaatggnnnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28381631 |
tggttttttggtatgatatggaatattggtgttaaagaacattgttttgattcttgttgatagatggatattcggaaggattttgaaatgg--tttttta |
28381534 |
T |
 |
| Q |
201 |
nnnnnnaagtgtagttaacgagattatggattctgattgattggtatattggttttcatttt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381533 |
ctttttaagtgtagttaacgagattatggattctgattgattggtatattggttttcatttt |
28381472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 33001212 - 33001261
Alignment:
| Q |
142 |
ttgttttgattcttgttgatagatgaatattcggaaggattttgaaatgg |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
33001212 |
ttgttttgattcttgttgatagatgcatattcgaaaggattctgaaatgg |
33001261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 207 - 242
Target Start/End: Original strand, 33001268 - 33001303
Alignment:
| Q |
207 |
aagtgtagttaacgagattatggattctgattgatt |
242 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33001268 |
aagtgtagttaacaagattatggattctgattgatt |
33001303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University