View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12360_low_11 (Length: 294)
Name: NF12360_low_11
Description: NF12360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12360_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 279
Target Start/End: Original strand, 28381720 - 28381983
Alignment:
| Q |
16 |
ttcaaaatatttcaccggaagcagccatcccccacgatcaattccatccgtcaccaccacccgccaccgcctacaagggcaaagctgatctgttagccac |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381720 |
ttcaagatatttcaccggaagcagccatctcccacgatcaattccatccgtcaccaccacccgccaccgcctacaagggcaaagctgatctgttagccac |
28381819 |
T |
 |
| Q |
116 |
atacgaaccatgcgaatatccaccaccattgttcacaatcggcgaatacgcgaaataaaccggttgaccggttggtccagtaatcggcctcatagcttga |
215 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28381820 |
ataagaaccatgcgaatatccaccaccattgtttacaatcggcgaatacgcaaaataaaccggttgaccagttggtccagtaatcggcctcatagcttga |
28381919 |
T |
 |
| Q |
216 |
tacaatccagaaggtgttggaatcaaataaaccggtaacggttcatttacataccccatcgaat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381920 |
tacaatccagaaggtgttggaatcaaataaaccggtaacggttcatttacataccccatcgaat |
28381983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 161 - 277
Target Start/End: Complemental strand, 28341879 - 28341763
Alignment:
| Q |
161 |
atacgcgaaataaaccggttgaccggttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccggtaacggttca |
260 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| || | ||||||||| ||||| |||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
28341879 |
atacgcgaaataaaccggttcaccaattggtccggttaccggcctcattgcttggtacaatcctgaagatgttggaatcaaataaaccggtaacagttca |
28341780 |
T |
 |
| Q |
261 |
tttacataccccatcga |
277 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
28341779 |
gttgaataccccgtcga |
28341763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University