View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12360_low_14 (Length: 260)
Name: NF12360_low_14
Description: NF12360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12360_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 12 - 118
Target Start/End: Complemental strand, 30545066 - 30544960
Alignment:
| Q |
12 |
acctgtgaaagttgttcttgattctgtagggtagtgggggtgaatgcagaatgatagctaccattttccttttcctgccatttcctagagcccaagctaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30545066 |
acctgtgaaagttgttcttgattctgtagggtagtgggggtgaatgcagaatgatagctaccattttcctttccctgccatttcctagagcccaagctaa |
30544967 |
T |
 |
| Q |
112 |
tgttatc |
118 |
Q |
| |
|
||||||| |
|
|
| T |
30544966 |
tgttatc |
30544960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 30544966 - 30544906
Alignment:
| Q |
152 |
tgttatcttataatattacaatcacaaggtacatatagtcatataaattaaagcttcttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30544966 |
tgttatcttataatattacaatcacaaggtacatatagtcatataaattaaagcttcttgt |
30544906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University