View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12360_low_17 (Length: 215)
Name: NF12360_low_17
Description: NF12360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12360_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 2925263 - 2925083
Alignment:
| Q |
16 |
gttctgatagggttggtagtgggaatttcagttcaagagaaggttctcgttctgctgtttctggttctagttatgtttcattggcgcaatttgatgaaga |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925263 |
gttctgataggattggtagtgggaatttcagttcaagagaaggttctcgttctgctgtttctggttctagttatgtttcattggcgcaatttgatgaaga |
2925164 |
T |
|
| Q |
116 |
gagtactaggtgaattttctgaaccttttattgtatttaattctgagttatttggtgaatattttgatatcttgttcttat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2925163 |
gagtactaggtgaattttctgaaccttttattgtatttaattctgagttatttggtgaatattttgatatctcgttcttat |
2925083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University