View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12361_high_5 (Length: 271)
Name: NF12361_high_5
Description: NF12361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12361_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 182 - 257
Target Start/End: Complemental strand, 6875822 - 6875747
Alignment:
| Q |
182 |
tgggtcttgaccattgtgttttgattctgtgtttaatttttaggtggtcctaaattaaggaaatggtatggtgcac |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6875822 |
tgggtcttgaccattgtgttttgattctgtgtttaatttttaggtggtcctaaattaaggaaatggtatggtgcac |
6875747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 119
Target Start/End: Complemental strand, 6875986 - 6875885
Alignment:
| Q |
18 |
atgtttctgttgctgttccattacttgtttgccatgctaagnnnnnnntcggnnnnnnngatcaaattctagattacattgaaggtacaacatggttgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6875986 |
atgtttctgttgctgttccattacttgtttgccatgctaagaaaaaaatcggtttttttgatcaaattctagattacattgaaggtacaacatggttgat |
6875887 |
T |
 |
| Q |
118 |
ac |
119 |
Q |
| |
|
|| |
|
|
| T |
6875886 |
ac |
6875885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University