View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12362_low_10 (Length: 266)
Name: NF12362_low_10
Description: NF12362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12362_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 36 - 249
Target Start/End: Original strand, 31500619 - 31500830
Alignment:
| Q |
36 |
gtaagttgaaatcatgggcctgtgactaagttaattccacaattcacaacaaccactttaagatggggtgtgtttacttcaatatctattagatcacttt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31500619 |
gtaagttgaaatcatgggcctgtgactaagttaattccacaattcacaacaaccactttaagatggtgtgtgtttacttcaatatctattagatcactt- |
31500717 |
T |
 |
| Q |
136 |
tgtgtatttgggactgtgtttatgtggttctcctgtattatgtattctctattaattttattttaaactatagggcgttgcagagggtctcctataggct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31500718 |
-gtgtatttgggactgtgtttatgtggttctcctgtattatgtattctcttttaattttattttaaactatagggcgttgcagagggtctcctataggct |
31500816 |
T |
 |
| Q |
236 |
atatgcatcccatt |
249 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31500817 |
atatgcatcccatt |
31500830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University