View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12362_low_15 (Length: 242)
Name: NF12362_low_15
Description: NF12362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12362_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 63 - 242
Target Start/End: Original strand, 29144847 - 29145026
Alignment:
| Q |
63 |
caagccaattggacagaacatgaaaaatggagctaaagtttatgagcaaaagaagaaaagcacagaggaaaatgtcactaacagttactcttctaagaca |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29144847 |
caagccaattggacagaacatgaaaaatggagctaaagtttatgagcaaaagaagaaaagcacagaggaaaatgtcactaacagttactcttctaagacg |
29144946 |
T |
 |
| Q |
163 |
attgattccattctgaaaaggagattggttaagccaaattctgactcaattactccacatggttcaactagatctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29144947 |
attgattccattctgaaaaggagattggttaagccaaattctgactcaattactccacatggttcaactagatctttgct |
29145026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University