View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12364_low_3 (Length: 391)
Name: NF12364_low_3
Description: NF12364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12364_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 2152637 - 2152262
Alignment:
| Q |
1 |
ggttaaaatcagcaatgggaaagtaattgaagtggttgcttcagagaaaggcttttacagtgttggaaagctgtctctgcagagtcacacattggttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2152637 |
ggttaaaatcagcaatgggaaagtaattgaagtggttgcttcagagaaaggcttttacagtgttggaaagctgtctctgcagagtcacacattggttgat |
2152538 |
T |
 |
| Q |
101 |
cttctgcaacagctcagcagaggttttgctaatgtaggtttctatttatgtacatatttatttgattgtcttgttattttctcagactgcactaaacctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||| |
|
|
| T |
2152537 |
cttctgcaacagctcagcagaggttttgctaatgtaagtttctatttatgtacatatttatttgattgtctttttattttctcaaactgcaccaaacctc |
2152438 |
T |
 |
| Q |
201 |
ttggtaactagtaaatgtttggttgcatttaagatttcattannnnnnngctacatattgtcttttaataatataatagtcatttaatttgttaaaagga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2152437 |
ttggtaactagtaaatgtttggttgcatttaagatttcattatttttttgttatatattgtcttttaataatataatagtcatttaatttgttaaaagga |
2152338 |
T |
 |
| Q |
301 |
ttcttatatactcttcaaagaaatttattttgattttagtaaattagtttgttagtttattctaacgattcatagc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2152337 |
ttcttatatactcttcaaagaaatttattttgattttagtaaattagtttgttagttttttctaacgattcatagc |
2152262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University