View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12364_low_5 (Length: 262)
Name: NF12364_low_5
Description: NF12364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12364_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 38123558 - 38123780
Alignment:
| Q |
12 |
agcagagaagagaggaagtgaatggatggaagaagcatagttgtagttagaggaggtgataggaattcccgccattggaatttggcagaagaagaagaga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38123558 |
agcaaagaagagaggaagtgaatggatggaagaagcatagttgtagttagaggaggtgataggaattcccgccattggaatttggcagaagaagaagaga |
38123657 |
T |
|
| Q |
112 |
taatggaatggaatggaatgaatgcagagaacgtaagagatattattgttaatatgaacggaacaagtagtagtgagaatgagaaaagtagtttggtcca |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38123658 |
t-----aatggaatggaatgaatgcagagaacgtaagagatattattgttaatat-----gaacaagtagtagcgagaatgagaaaagtagtttggtcca |
38123747 |
T |
|
| Q |
212 |
actgatatttatgtcagtttttggtgcatgatg |
244 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |
|
|
| T |
38123748 |
acttatatttatgtcagtttttggtgcatgatg |
38123780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University