View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12368_high_14 (Length: 246)
Name: NF12368_high_14
Description: NF12368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12368_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 47 - 104
Target Start/End: Original strand, 23705983 - 23706040
Alignment:
| Q |
47 |
catcctccacagctacttctggacattttgatttctcacctctgctcaatgtaagctc |
104 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23705983 |
catcctccacagttactcctggacattttgatttctcagctctgctcaatgtaagctc |
23706040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 23620429 - 23620377
Alignment:
| Q |
173 |
atcatatggttgacccaagtcttcttcctcttttcatttttcactcactagggaat |
228 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23620429 |
atcatatggttgacccaagtcttc---ctcttttcatttttcactcactagggaat |
23620377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 23651774 - 23651722
Alignment:
| Q |
173 |
atcatatggttgacccaagtcttcttcctcttttcatttttcactcactagggaat |
228 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23651774 |
atcatatggttgacccaagtcttc---ctcttttcatttttcactcactagggaat |
23651722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 173 - 228
Target Start/End: Complemental strand, 23737208 - 23737156
Alignment:
| Q |
173 |
atcatatggttgacccaagtcttcttcctcttttcatttttcactcactagggaat |
228 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23737208 |
atcatatggttgacccaagtcttc---ctcttttcatttttcactcactagggaat |
23737156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 173 - 228
Target Start/End: Original strand, 23706528 - 23706581
Alignment:
| Q |
173 |
atcatatggtt-gacccaagtcttcttcctcttttcatttttcactcactagggaat |
228 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23706528 |
atcatatggtttgacccaagtctt---cctcttttcatttttcactcactagggaat |
23706581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 104
Target Start/End: Complemental strand, 23620951 - 23620902
Alignment:
| Q |
55 |
acagctacttctggacattttgatttctcacctctgctcaatgtaagctc |
104 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
23620951 |
acagctactcctggacgttttgatttctcagccctgctcaatgtaagctc |
23620902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 104
Target Start/End: Complemental strand, 23652296 - 23652247
Alignment:
| Q |
55 |
acagctacttctggacattttgatttctcacctctgctcaatgtaagctc |
104 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
23652296 |
acagctactcctggactttttgatttctcagccctgctcaatgtaagctc |
23652247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 140
Target Start/End: Original strand, 23706056 - 23706089
Alignment:
| Q |
107 |
tgttatttgcatatgtgtggtgtgtgctgtattt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23706056 |
tgttatttgcatatgtgtggtgtgtgctgtattt |
23706089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 104
Target Start/End: Complemental strand, 23737730 - 23737681
Alignment:
| Q |
55 |
acagctacttctggacattttgatttctcacctctgctcaatgtaagctc |
104 |
Q |
| |
|
||||||||| |||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
23737730 |
acagctactcctggacgttttgatttctcagccctgctcaatgtaagctc |
23737681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University