View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12368_high_6 (Length: 348)
Name: NF12368_high_6
Description: NF12368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12368_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 337
Target Start/End: Original strand, 46078967 - 46079286
Alignment:
| Q |
18 |
ctatcagctagtgctgcctgaagtaattctgcgccttgagtagccagatgtaattcagattgtattggctccagcgactcgtctaaggttgatgctctgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46078967 |
ctatcagctagtgctgcctgaagtaattctgcgccttgagtagccagatgtaattcagattgtcttggctccagcgactcgtctaaggttgatgctctgt |
46079066 |
T |
 |
| Q |
118 |
tagcacgcttgtttgctaggcaactgcaagaactcccacaactattccccatagctttgcacttgcattttgttgtcttgcacgttgagcttttgctaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46079067 |
tagcacgcttgtttgctaggcaactgcaagaactcccacaactattccccatagctttgtactcgcattttgttgtcttgcacgttgagcttttgctaca |
46079166 |
T |
 |
| Q |
218 |
agaacaacaattacctccaaatctattactcaatttgtcgctgaaatcttcggaatgtcttcttttagattccccttttccaacccttaattttcctgat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46079167 |
agaacaacaattacctccaaatctattactcaatttgtcactgaaatcttcggaatgtcttcttttagattccccttttccaacccttaattttcctgat |
46079266 |
T |
 |
| Q |
318 |
tctttccactcatcatctgt |
337 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46079267 |
tctttccactcatcatctgt |
46079286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University