View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12368_low_12 (Length: 289)
Name: NF12368_low_12
Description: NF12368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12368_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 274
Target Start/End: Original strand, 7494679 - 7494942
Alignment:
| Q |
12 |
cagcacagaaccgactattattcatcgatcccaaaactcttcttttgacacagtctgaaagagtgagtataatttgtctatttgttgctttttcttattt |
111 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||| || |
|
|
| T |
7494679 |
cagcacaaaaccgactattattcattgatcccaaaactcttcttttgacacagactgaaagagtgagtgtaatttgtctatttattgctttttcttactt |
7494778 |
T |
|
| Q |
112 |
agttggacagattcttgttgtcttggcttattatgttagttgattaatttaagtatcttg-tttcnnnnnnntcggtgcactagtgggggtaagatttac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
7494779 |
agttggacagattcttgttgtcttggcttattatgttagttgattaatttaagtatcttgttttaaaaaaaatcggggcactagtgggggtaagatttac |
7494878 |
T |
|
| Q |
211 |
ctcatctgaccaagaggagagtgatcacataaatgagaattgagatgataattttgaagaaaat |
274 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7494879 |
ctcatctgacaaagaggagagtgatcacataaatgagaattgagatgataattttgaagaaaat |
7494942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University