View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12368_low_14 (Length: 255)
Name: NF12368_low_14
Description: NF12368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12368_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 236
Target Start/End: Complemental strand, 27752187 - 27751961
Alignment:
| Q |
10 |
gcagagagcatgctaataagtacattgaatgcatacatacatggatttgaaagaagcgtgtagtggtggcagttacaacacggaatggctatagccgcgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27752187 |
gcagagagcatgctaataagtacattgaatgcatacatacatggatttgaaagaagcgtgtagtggtggcagttacaacacggaatggctatagccgcgc |
27752088 |
T |
|
| Q |
110 |
atttactcttgactctgcatagtaatgcaattggacccccacaactaccaactacacctatagatatagattcattaataatattatggttggcaaaatg |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27752087 |
atttactcctgactctgcatagtaatgcaattggacccccacaactaccaactacacctatagatatagattcattaataatattatggttggcaaaatg |
27751988 |
T |
|
| Q |
210 |
tcactcttatatatgtagcctcttcat |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27751987 |
tcactcttatatatgtagcctcttcat |
27751961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University