View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12368_low_6 (Length: 354)
Name: NF12368_low_6
Description: NF12368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12368_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 52243016 - 52242684
Alignment:
| Q |
1 |
gtagaatgagaggctgtggtgtgttcattttgatttcagttacaatatgtagacatttgatttatttagtatcacaaattattcacactttatccatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52243016 |
gtagaatgagaggctgtggtgtgttcattttgatttcagttacaatatgtagacatttgatttatttagtatcacaaattattcacactttatccatatt |
52242917 |
T |
|
| Q |
101 |
gtattatgtggttttgcaatttctactagatttccattgccacctaactctgtcctcggtgacaattcaaattattatcatttcaaaattctcttcactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52242916 |
gtattatgtggttttgcaatttctactagatttccagtgccacctaactctgtccttggtgacaattcaaattattattatttcaaaattctcttcactg |
52242817 |
T |
|
| Q |
201 |
acatcattgttctttctcacaaacctctcagttcagttcagttctgttctgttctgttatgttccattcctcgctataacaataacaatttcccgccaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242816 |
acatcattgttctttctcacaaacctctcagttcagttcagttctgttctgttccatt-----ccattcctcgctataacaataacaatttcccgccaga |
52242722 |
T |
|
| Q |
301 |
ttttgaatggagagattttatagttattctgaacaacg |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52242721 |
ttttgaatggagagattttatagttattctgaacaacg |
52242684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University