View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12369_low_5 (Length: 257)
Name: NF12369_low_5
Description: NF12369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12369_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 182676 - 182450
Alignment:
| Q |
15 |
cagagaatgaaacaagtataccaagatgtccaaccatcataagagaaaccacttgaagaagatattgtgaaacagttacagctaccattggagctgccac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
182676 |
cagagaatgaaacaagtataccaagatgtccaaccatcataagagaaaccacttgaagaagatattgtgaaacagttacagctaccattggagctgcaac |
182577 |
T |
 |
| Q |
115 |
gaaactcactttcttcaactcttgaacaaatgtactctcaatctc---atcattctttcttatcaatggtgttgtcacctccttactcatctctctagag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
182576 |
gaaactcactttcttcaactcttgaacaaatgtactctcaatctcatgatcactctttcttatcaatggtgttgtcacctccttactcatctctctagag |
182477 |
T |
 |
| Q |
212 |
ttgtttttcattaaatgtgatcactat |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
182476 |
ttgtttttcattaaatgtgatcactat |
182450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University